Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ620935
Length 357 bp
Fasta Format > rwhvh7d21
gcagccgctctgntcaagagacggntttgacaaaaaaggttccagcaaga ggtcaaatacttggacctgacatggcatatacggaaggaaaatgtaccca tgcttgactcagcatggacagaaggtatatatagatccccaacagactga tggttttcgatcatcatgttaacatagatgtttgtcgtactattgataag ccgtagggcggatcgcgtagcatccgcagtccgccaactggagatcactt ccttaagccctccatgatgtacgaaccgtagaggtccatcgagtacttga ttgcgttgatggcatcttctgctgggaggaaatcattcactgcaacctcc ttgtttt
Download
page-top