Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ620685
Length 591 bp
Fasta Format > rwhvh6c18
gtatatactctccgtccatctcttccatcagagctggtctcgacctgtaa caacgacgacacactggctggctaaggtgccctcaagctgctcaaggcgc tactagcactctccctccataggtagataattagatagatagctcgccga cggatcagtagctgtagttcttgacgaacatgttctcgctggcttccgcg gcctcgccgtcgctggtgtacttgccgagctgcgccagggagttggcctt ggcgcgcagcagcagcgcctcctgcgccgcggccacgttctccggccgcc caccccacgtcttgaggcaggtgttctggagcgcccgcgcgtaggagaag gacacgtgccacgggttcggcgcctggttcatcgcgttcaggttcagcgt cgcctccacctccgactgaccgccagacaagaacatgatgccggggacgg aaggggggatccttctctggaggagcttgagggtgtanctggccacttcc tcgggggnggccctgnccttgnactcnnnaccnngggtnancatgcttgn nttnnngangatgncctcnaacntnacnntgnnctnnnnna
Download
page-top