Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ620110
Length 604 bp
Fasta Format > rwhvh3i02
ggtatactcaatatctttttatattaacaaaacatgcccagcaatcgctt ggatgcgatgcggtacttaggtacaaaggataaaacatcagatattaaat tggcatgcttaaaaggtgtaaaggcagctcccgtcgtcactcctcgccgt tgggtcgaagttcttggcagtctggtcggtgcatcctgccggtacaggca aagtaccttgctgtgcccctttacctcctcctatgcagcaagagatggtg ggtgtctatggagaatgttctaaccgtagaaggaaccagtcttcatcgca tcctggttagcatcacccagagctgcctggctcatgtaggtgtcagcaag ctgcacacgcttgacattgtcctgctcctggacaagcatgtgcccgtact ctagcagcttctccactgtcatctttggctgctcaaaggtcacgggtccg tcccgcgagttcaccagcctcttgccaatgttctcgataccggtagaggt cacccacttgcgcacctcgtcgtcgtacacccgagcacgcagagcaccga aaaagtcnatggattgtcctgggaaggtgtcgacnatcttgacnacggac tcgt
Download
page-top