Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ620084
Length 519 bp
Fasta Format > rwhvh3f23
tgcgatgcggtacttaggtacaaaggataanacntcagatattaaattgg cntgcttaaaaggtgtaaaggcagctcccgtcgtcactcctcnccgttgg gtcgaagttcttggcagtctggtcggtgcatcctgccggtacaggcaaag taccttgctgtgcccctttacctcctcctatgcagcaagagatggtgggt gtgtatggagaatgttctaaccgtagaaggaaccagtcttcatcgcatcc tggttagcatcacccagagctgcctggctcatgtaggtgtcagcaagctg cacacgcttgacattgtcctgctcctggacaagcatgtgcccgtactcta gcagcttctccactgtcatctttggctgctcaaaggtcacgggtccgtcc cgcgagttcaccancctcttgccaatgttctcnataccggtanaggtcac ccacttgcgcacctcnncgtcntacacccnancacncnnancaccnaaaa antcnatggattgtcctgg
Download
page-top