Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ619974
Length 705 bp
Fasta Format > rwhvh2o06
catatctttttatattaacaaaacatgcccagcaatcgcttggatgcgat gcggtacttaggtacaaaggataaaacatcagatattaaattggcatgct taaaaggtgtaaaggcagctcccgtcgtcactcctcgccgttgggtcgaa gttcttggcagtctggtcggtgcatcctgccggtacaggcaaagtacctt gctgtgcccctttacctcctcctatgcagcaagagatggtgggtgtgtat ggagaatgttctaaccgtagaaggaaccagtcttcatcgcatcctggtta gcatcacccagagctgcctggctcatgtaggtgtcagcaagctgcacacg cttgacattgtcctgctcctggacaagcatgtgcccgtactctagcagct tctccactgtcatctttggctgctcaaaggtcacgggtccgtcccgcgag ttcaccagcctcttgccaatgttctcgataccggtagaggtcacccactt gcgcacctcgtcgtcgtacacccgagcacgcanagcaccgaaaaagtcga tggattgtcctgggaaggtgtcgacgatcttgacgacggactcntcnctg acattgtcggtctggaanatacccttgcanacaccnatacngtcgtcncg gntgggancccannanaacttctccatacngccntcacngatcananggg cgnac
Download
page-top