Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ619395
Length 717 bp
Fasta Format > rwhvh1g12
ataggtatactcaatatctttttatattaacaaaacatgcccagcaatcg cttggatgcgatgcggtacttaggtacaaaggataaaacatcagatatta aattggcatgcttaaaaggtgtaaaggcagctcccgtcgtcactcctcgc cgttgggtcgaagttcttggcagtctggtcggtgcatcctgccggtacag gcaaagtaccttgctgtgcccctttacctcctcctatgcagcaagagatg gtgggtgtgtatggagaatgttctaaccgtagaaggaaccagtcttcatc gcatcctggttagcatcacccagagctgcctggctcatgtaggtgtcagc aagctgcacacgcttgacattgtcctgctcctggacaagcatgtgcccgt actctagcagcttctccactgtcatctttggctgctcaaaggtcacgggt ccgtcccgcgagttcaccagcctcttgccaatgttctcgataccggtaga ggtcacccacttgcgcacctcgtcgtcgtacacccgagcacgcanagcac cgaaaaagtcgatggattgtcctgggaaggtgtcnacgatcttgacnacn gactcntcgctgacattgtcngtctggaagatacccttgcanacaccgat acngncgtcncgggtgggancccannanaacttctccatacngccatcac ngatcanangggnntac
Download
page-top