Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ617302
Length 855 bp
Fasta Format > rwhvh11h08
aataggtatactcaatatctttttatattaacaaaacatgcccagcaatc gcttggatgcgatgcggtacttaggtacaaaggataaaacatcagatatt aaattggcatgcttaaaaggtgtaaaggcagctcccgtcgtcactcctcg ccgttgggtcgaagttcttggcagtctggtcggtgcatcctgccggtaca ggcaaagtaccttgctgtgcccctttacctcctcctatgcagcaagagat ggtgggtgtgtatggagaatgttctaaccgtagaaggaaccagtcttcat cgcatcctggttagcatcacccagagctgcctggctcatgtaggtgtcag caagctgcacacgcttgacattgtcctgctcctggacaagcatgtgcccg tactctagcagcttctccactgtcatctttggctgctcaaaggtcacggg tccgtcccgcgagttcaccagcctcttgccaatgttctcgataccggtag aggtcacccacttgcgcacctcgtcgtcgtacacccgagcacgcagagca ccgaaaaagtcgatggattgtcctgggaaggtgtcgacgatcttgacgac ggactcgtcgctgacattgtcggtctggaagatacccttgcagacaccga tacggtcgtcgcgggtgggagcccagtanaacttctccatacggccatca cggatcanaggggcgtacaacgtcnagaaatcgttaccantgacgacgat gggcacacnagggttctcctccttgttgtacatgcctgggagctgcacgt tggtggggggcatcngcgatgttcatgagggtggcgttcaccannctggt tgttg
Download
page-top