Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ617012
Length 804 bp
Fasta Format > rwhvh10f09
attgagagaaaataaaatacataagctgcttactttggtggaagcaattt gtaagcttccaagtaagttatgtactgctaagatcagtttgcggttgccg aactgtgttgcgttttgcttattttataatgtatttgtgaacaaattacc caccaaagtatgcataaacaggtcaaacaagcactaaaaaattagacaaa aaaggactggcaaacgggattgtcataatccaccataacgctaaacgcat cctgatacttaacactggttggactagatgattatagcactattctctgg gctaaagagcatctccaacaagtccctttcccgtaacaaaaagctggttt agagtgagttggacgagaaaaaactgctccaacaggtccgtaagcacgat ttttctttaggaaacaccgtataatcagctcaacttcccctcaattctag gggaatatagcccttcccgtaaacctttcctaaacatagcgcaaaaaaga aaactttttctcccgggtgaagtttcacgtaccttcgcctgtagcccccg ccgaccctgacgtccgtcacgccgccgatcccgatcagttgcccgtgtcc gtcgtggcctcgtcgcccgccttggctgactccaccatcggccatcgccg ccaacccggcccgggcagcccaacgggcaagcagctcgtccgtagccaac ctgcggggaagtagggaagcgccattccccgccacctcgtcatgccggcg aagaaaatagaggaagagtacaagatcatgctcacgagacctgtaggttt tgac
Download
page-top