Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ616997
Length 820 bp
Fasta Format > rwhvh10e10
ccatccagaaagtaacacgaacaaaataagataactgaacgctggctagg aatgtcgacagaagtactcaagaaatcagccatcaaaactgactacaaag ttcacgacacccaggtggcacatatatcatcttctagatatgaagcagca aaatagcgacttctattttctactcagcagcagcaacctcctccgctcca ggaatcacctcatctccatcagcaggcctgtcaagcttcacaccaacatc ctccttgtagtcaccgtgcacctccatgagcttccccaggtcaaacttgg gggccttcaggatcttcaccttgcggacgtacacgttctggagggggaag atgcttgaggtggccttctcaatctcctttccaatcacctcagggatgaa cttgttcacaagctccttcaagtcacagcttgcagcttggttgaccatga tctcaaccatcttgcggcggatctgtctgatctgacttgcttgggcatag caagtgcgcttcacctggtttgggcgtctcttcgtgaagccaatggtgaa catgcggagcatgtagttgtcagtggtcttcacatccacatgagcctcaa tgagtgtctgccacttcctcacaagagacctgagcttgtcagtggtgaag tccatgccccagaagtttgtgaggacattcatcccttgcacatcctcagc acggagtctgatcttcctgtaggcctggtcctcatcgttctgaagatcag ctanagatacttcnaacaccctgtgcttcagaccctctgaggcaatcttg gtaccctgtgtcctggacac
Download
page-top