Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ723596
Length 416 bp
Fasta Format > whvh20k24
ggtgtttcaggccgttctgctgctttgttcggtgtatctggtcggcctcg cttcgatcgttcaatctagaggcgtcgccgccgcggacggcagaggcatg atcctggtcggacccttcgtcttcaacgtcggggacgtgggtgaggaaga cgtcggtgccgcggacggtggcggtgtgtgtggtctggatcggactgttg gttttgatctgacggcttaaacagaccagttagatctattagtttaacag aaaaaaaaggagaaagataacgttaatgaaaaggccccacgcaccaacgt acgtgaggtttttatctcaactaaggcgccctgatcgggggcacccaaac caactgatggtttangtcccctgtcgccagccctacataaaagggaacgg gagagggttggcancc
Download
page-top