Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ723505
Length 803 bp
Fasta Format > whvh20e15
tcgaccaagcagcaccgagatggctgctgccttctcctccaccgttcggt gccccggcttctacgccgaccaacttccttgggaagaagctcaagaagca ggtgacctcggccgtgaactaccatggcaagagctccaaggccaacaggt tcacagtcatggcagcggaaaacctcgacgagaagaggaacacggacaag tggaagggtcttgcgtacgatatctccgacgaccagcaggacatcaccag agggaagggcatcgtggactcgctcttccaggcgcccacgggcgacggca cccacgaggccgtcctcagctcctacgagtacgtcagccagggactcaag aagtacgacttcgacaacaccatgggaggcttctacatcgctcctgcttt catggacaagcttgttgtccatctctccaagaacttcatgaccctgccca acatcaagatcccactcatcttgggtatctggggaggcaagggtcaagga aaatcattccagtgcgagcttgtcttcgccaagatgggcatcaacccaat catgatgagtgccggagagctggagagtggcaacgccggagagccagcca agctcatcaggcagcggtaccgtgaggctgcagacatgatcaagaagggt aagatgtgctgcctcttcatcaacgatcttgacgctggtgcgggtcggat gggcgggaccacacagtacaccgtcnaacaaccagatggtgaacgccacc ctcatgaacatcgccgatgcccccacccaacgtgcagctccccaggcatg tac
Download
page-top