Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ723452
Length 838 bp
Fasta Format > whvh20a09
ttccgctcaacatggnctcctcaggtgtggatggttggggaggacggcga ggacctcaagaaccacggggagctcctgcctctctccaagctccaagaga ttggtgtgttatactggcatttggacccaaagaagcctgaaagcgaagaa gagctagcgaagatccgcaaagacagaggatacaactacatggactatct cgacatatgccctggaaagttggcaaactttgaggagaagctcaagaact tcttcacagagcacatgcatgccgacgaagagatccggtactgcttggaa ggcggcgggtactttgatgtgcgcgacaaggatgacaagtgggttcggat ctggataaaagaagggggcatgatcgtgctgccggctggaatttatcatc ggttcaccctcgacgccgccaaccatgtgaagctcatgaggctcttcctg ggagaaccagtgtggacggcgcacaaccggcctcaggaggaccatccggt gcggcaagagtatgtcaagaggctcacggacgacaatgctggtcttgctc tggcagcacactgaagtttgtttgtgattcctcagctatgttttataaac acccatggacatatacatacacttggatgaaaccgtgttgtaatcttgaa accagatagatatgctacctacgtacagtacttgttaatattcactaggt aattgcatgtgctatactgccatatcaaactctcaagtgcttaaacccag ttttgattttaatcctttgtattcanattctaattantagttgcattaac cggacagtaatttttcagtccacacatcaaaaaaaaaa
Download
page-top