Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ723010
Length 816 bp
Fasta Format > whvh19b13
atcttgcttgcattgaccatagaggcacaccacagcatccggccaggacc tgcacccttgaatccgaagatgaagccatatgctggggaattgcttattg tgtcaaaggtggtctagaaaaagagcgagaagcaatgcagtacttggaga gaagagaatgcgagtatgaccagaagatctctgtggatttctacaaggat ggaaattctctggaaccagctgtgacggatgtattagttttcgtatccac tcctgatccagttggcaacaaatactatcttggccctgctgctttggagg atatggcaaggcaaattgctacagccagtggccctaatggatataatagg gactacctgttctcaatggagaaggcactgtccaatataagccatgaaga cgactcgatcattgtgcttgcggatgaggtgaggaaggtgctgagcaggt cgacggagaagaaggttaccggctccgacataccattaaaatcgcataca cctgttgtgcacatctctgctcttcctgagggcaccgttgcggtttcaac atagtaagaagagcagcacggctggatcagcgaaagagatggcattttcc tctgaccacactcactcttgacattctaccattgaaagatctgtggttta cttcagctctggcaccattgagggtgtgcgctaattttctttggcaacta ttgtggcaaaggctgtagcttccagagtgctaatgcgaaagcctaagact tcaagtgttattgcttcccttgtgataccctaataataaatgcatttggc gacttcaaaaaaaaaa
Download
page-top