Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ722901
Length 854 bp
Fasta Format > whvh18k01
ttcatcaccgatcaccagcacagccgcgcatccaccgttgctagcaaggt cgaccaagcagcaccgagatggctgctgccttctcctccaccgtcggtgc cccggcttctacgccgaccaacttccttgggaagaagctcaagaagcagg tgacctcggccgtgaactaccatggcaagagctccaaggccaacaggttc acagtcatggcagcggaaaacctcgacgagaagaggaacacggacaagtg gaagggtcttgcgtacgatatctccgacgaccagcaggacatcaccagag ggaagggcatcgtggactcgctcttccaggcgcccacgggcgacggcacc cacgaggccgtcctcagctcctacgagtacgtcagccagggactcaagaa gtacgacttcgacaacaccatgggaggcttctacatcgctcctgctttca tggacaagcttgttgtccatctctccaagaacttcatgaccctgcccaac atcaagatcccactcatcttgggtatctggggaggcaagggtcaaggaaa atcattccagtgcgagcttgtcttcgccaagatgggcatcaacccaatca tgatgagtgccggagagctggagagtggcaacgccggagagccagccaag ctcatcaggcagcggtaccgtgaggctgcagacatgatcaagaagggtaa gatgtgctgcctcttcatcaacgatcttgacgctggtgcgggtcggatgg gcgggaccacacagtacaccgtcaacaaccagatggtgaacgccaccctc atgaacatcgccgatgcccccaccaacgtgcagctcccaggcatgtacaa caag
Download
page-top