Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ722831
Length 841 bp
Fasta Format > whvh18f05
gccggtcattcatcaccgatcaccagcacagccgcgcatccaccgttgct agcaaggtcgaccaagcagcaccgagatggctgctgccttctcctccacc gtcggtgccccggcttctacgccgaccaacttccttgggaagaagctcaa gaagcaggtgacctcggccgtgaactaccatggcaagagctccaaggcca acaggttcacagtcatggcagcggaaaacctcgacgagaagaggaacacg gacaagtggaagggtcttgcgtacgatatctccgacgaccagcaggacat caccagagggaagggcatcgtggactcgctcttccaggcgcccacgggcg acggcacccacgaggccgtcctcagctcctacgagtacgtcagccaggga ctcaagaagtacgacttcgacaacaccatgggaggcttctacatcgctcc tgctttcatggacaagcttgttgtccatctctccaagaacttcatgaccc tgcccaacatcaagatcccactcatcttgggtatctggggaggcaagggt caaggaaaatcattccagtgcgagcttgtcttcgccaagatgggcatcaa cccaatcatgatgagtgccggagagctggagagtggcaacgccggagagc cagccaagctcatcaggcagcggtaccgtgaggctgcagacatgatcaag aagggtaagatgtgctgcctcttcatcaacgatcttgacgctggtgcggg tcggatgggcgggaccacacagtacaccgtcaacaaccagatggtgaacg ccaccctcatgaacatcgccgatgcccccaccaacgtgcag
Download
page-top