Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ722790
Length 911 bp
Fasta Format > whvh18c03
gttcagttgcttattctgtcctgtctgcacacactgagagcaatatgggt ggcaaggttcttctgatgagtgccgtcttggtggggcttgtttcactgag ctcgtgcaggagcctgggagagttgcatgagcagaagacccactatgggg gctcaccaactcccacgcatgggtcaggaggaggctacaacccgacactg acaccgacaccaacttacggcactacaccgacgccatcttacggcactac accgacaccaacttacggcattacaccgacgccaacttacggcactacac cgacgccatcttacggcactacaccgacgccatcttatggcactacaccg agcaccccaagtgcaccttcccatgatgtccctgcaagtccaaagaagca tgggttcattggatcctgcgactactggaagaatcacccagatgctatag ttgcagctattgggtccctcggcaacatcggcaagacatttggtgctgca tgcagtatgataggtggcaagaagctaggaaatatgcatgatgcactctc aaacactagaactgatggtattggcgccctgatacgtgagggggcagctg catacctcaactccattgtgaacaagaagttcccatttaccacccagcag gtgaaggactgtatcgtcgtggccgtgacctctgatggtgctgcttctgc ccaagctggggttttcaagaaggcaaatgaattccactactagtttcagt catcggtgtttcttggctaaatttcttcctcccgcgcatttttcttgatt gatgctatcttgtggcttgatatatttcttttatttttgttgttttatca tgtaatatcactatctatggcattttgagtgcaataaatccatccttttc caaaaaaaaaa
Download
page-top