Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ722675
Length 756 bp
Fasta Format > whvh17l01
ggctgcaattgtaaggtgtgtcaaagaagagggtagcacctgatctgctt gcctccagaaacaatggcgtctgctactctcctcaagtcgtctttccttc ccaagaaggccgaatggggcgccacgcgccaggctgccgcccccaagccg atgaccgtctccatggttgtccgtgccagcgcgtacgccgatgagcttgt caaaaccgcgaaaaccatcgcatcgccaggcaggggtatccttgccatgg atgagtcgaatgccacctgtggcaagagactcgcctcgattggccttgag aacactgaggctaaccgccaggcttaccggaccctccttgtcactccacc aggattgggaaactacatctctggtgctatcctctttgaggagaccctct accagtcgactgttgatggcaagaagattgttgacatccttgtcgagcag ggaatcgttcccggtatcaaggttgacaagggtcttgtgccacttgttgg ttccaacgatgagtcatggtgccaaggtctcgatggccttgcctcccgtg aagcagcatactaccagcaaggcgcccgcttcgccaagtggcgcactgtt gtcagcattcctaatggcccatctgagcttgctgtcaaggaagctgcctg gggtcttgcccgttacgcggccatctcacaggacaatgggctggtgccga ttgtggagcctgagatcatgctcgacggtgagcacggcatcgagaggacc ttcgag
Download
page-top