Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ722614
Length 875 bp
Fasta Format > whvh17h05
gtgcccgaccatcgacggcggcgtcgactccttccccttcaaggccggca agtacgagatgaagaagttctgcctggagcccacctccttcaccgtcaag gccgagggcatccagaagaacgagccgccggccttccagaagaccaagct catgacccgtctcacctacacccttgacgagatggaaggcccgctcgagg tcggcgccgacggcaccctcaagttcgaggagaaggacggcatcgactac gcggccgtcaccgtgcagctccccggaggcgagcgcgtgcccttcctctt caccgtcaagcagctcgtcgccaccggcaagcccgagagcttcagcgggc ccttcctcgtgcccagctacaggggttcgtctttcctcgacccaaagggc cgtggtggctctactggctacgacaacgccgtggcgctacccgccggagg cagaggagacgaggaggagttggccaaggagaacgtgaagaacgcgtcct cctccacgggcaacatcacgctcagcgtcaccaagagcaagccggagacc ggcgaggtgatcggcgtcttcgagagcgtgcagccgtcagacaccgacct cggcgccaaggcgcccaaggatgtcaagatccagggtgtgtggtacgcgc agctcgagtctaactagagcagagcanaagtgaagatactcatcttgtgt gcatgcgtacgtgggttgatcggtggagaggaaacaatcgaggcaacaat gtgtgtttgtgtgtgtatctagtaatctaaacccagggtgtcggtttata ttttancttctgttattgttttcttcctcgcctactcatgatattgatcc cccatgaatgttcacaaaaaaaaaa
Download
page-top