Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ722525
Length 826 bp
Fasta Format > whvh17b02
ccgatcaccagcacagccgcgcatccaccgttgctagcaaggtcgaccaa gcagcaccgagatggctgctgccttctcctccaccgtcggtgccccggct tctacgccgaccaacttccttgggaagaagctcaagaagcaggtgacctc ggccgtgaactaccatggcaagagctccaaggccaacaggttcacagtca tggcagcggaaaacctcgacgagaagaggaacacggacaagtggaagggt cttgcgtacgatatctccgacgaccagcaggacatcaccagagggaaggg catcgtggactcgctcttccaggcgcccacgggcgacggcacccacgagg ccgtcctcagctcctacgagtacgtcagccagggactcaagaagtacgac ttcgacaacaccatgggaggcttctacatcgctcctgctttcatggacaa gcttgttgtccatctctccaagaacttcatgaccctgcccaacatcaaga tcccactcatcttgggtatctggggaggcaagggtcaaggaaaatcattc cagtgcgagcttgtcttcgccaagatgggcatcaacccaatcatgatgag tgccggagagctggagagtggcaacgccggagagccagccaagctcatca ggcagcggtaccgtgaggctgcagacatgatcaagaagggtaagatgtgc tgcctcttcatcaacgatcttgacgctggtgcgggtcggatgggcgggac cacacagtacaccgtcaacaaccaggatggtgaacgccaccctcatgaac atcgccgatgcccccaccaacgtgca
Download
page-top