Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ722039
Length 805 bp
Fasta Format > whvh14o23
gggtagcacctgatctgcttgcctccagaaacaatggcgtctgctactct cctcaagtcgtctttccttcccaagaaggccgaatggggcgccacgcgcc aggctgccgcccccaagccgatgaccgtctccatggttgtccgtgccagc gcgtacgccgatgagcttgtcaaaaccgcgaaaaccatcgcatcgccagg caggggtatccttgccatggatgagtcgaatgccacctgtggcaagagac tcgcctcgattggccttgagaacactgaggctaaccgccaggcttaccgg accctccttgtcactccaccaggattgggaaactacatctctggtgctat cctctttgaggagaccctctaccagtcgactgttgatggcaagaagattg ttgacatccttgtcgagcagggaatcgttcccggtatcaaggttgacaag ggtcttgtgccacttgttggttccaacgatgagtcatggtgccaaggtct cgatggccttgcctcccgtgaagcagcatactaccagcaaggcgcccgct tcgccaagtggcgcactgttgtcagcattcctaatggcccatctgagctt gctgtcaaggaagctgcctggggtcttgcccgttacgcggccatctcaca ggacaatgggctggtgccgattgtggagcctgagatcatgctcgacggtg agcacggcatcgagaggaccttcgaggtcgcgcanaaggtgtgggcggan accttctactacatggcccanaacaacgtcatgtttgagggcatcctcct gaagc
Download
page-top