Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ721603
Length 385 bp
Fasta Format > whvh13b12
cagggactcaagaagtacgacttctgacaacacnntggnaggcttctaca tcgctcctgctttcatggacaagcttgttgtccatctctccnagaacttn atgaccctgcccaacatcaanatcccactcatcttgggtatctggggagg caagggtcaaggaaaatcattccagtgcgagcttgtcttcgccaagatgg gcatcaacccaatcatgatgagtgccggagagctggagagtggcaacgcc ggagagccagccaagctcatcaggcagcggtaccgtgaggctgcagacat gatcaagaagggtaagatgtgctgcctcttcatcaacgatcttgacgctg gtgcgggtcggatgggcgggaccacacagtacacc
Download
page-top