Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ725400
Length 814 bp
Fasta Format > whvh9o08
gtcattcatcaccgatcaccagcacagccgcgcatccaccgttgctagca aggtcgaccaagcagcaccgagatggctgctgccttctcctccaccgtcg gtgccccggcttctacgccgaccaacttccttgggaagaagctcaagaag caggtgacctcggccgtgaactaccatggcaagagctccaaggccaacag gttcacagtcatggcagcggaaaacctcgacgagaagaggaacacggaca agtggaagggtcttgcgtacgatatctccgacgaccagcaggacatcacc agagggaagggcatcgtggactcgctcttccaggcgcccacgggcgacgg cacccacgaggccgtcctcagctcctacgagtacgtcagccagggactca agaagtacgacttcgacaacaccatgggaggcttctacatcgctcctgct ttcatggacaagcttgttgtccatctctccaagaacttcatgaccctgcc caacatcaagatcccactcatcttgggtatctggggaggcaagggtcaag gaaaatcattccagtgcgagcttgtcttcgccaagatgggcatcaaccca atcatgatgagtgccggagagctggagagtggcaacgccggagagccagc caagctcatcaggcagcggtaccgtgaggctgcagacatgatcaagaagg gtaagatgtgctgcctcttcatcaacgatcttgacgctggtgcgggtcgg atgggcgggaccacacagtacaccgtcaacaaccagatggtgaacgccac cctcatgaacatcg
Download
page-top