Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ725338
Length 767 bp
Fasta Format > whvh9j14
ggcaacgccggagagccagccaagctcatcaggcagcggtaccgtgaggc tgcagacatgatcaagaagggtaagatgtgctgcctcttcatcaacgatc ttgacgctggtgcgggtcggatgggcgggaccacacagtacaccgtcaac aaccagatggtgaacgccaccctcatgaacatcgccgatgcccccaccaa cgtgcagctcccaggcatgtacaacaaggaggagaaccctcgtgtgccca tcgtcgtcactggtaacgatttctcgacgttgtacgcccctctgatccgt gatggccgtatggagaagttctactgggctcccacccgcgacgaccgtat cggtgtctgcaagggtatcttccagaccgacaatgtcagcgacgagtccg tcgtcaagatcgtcgacaccttcccaggacaatccatcgactttttcggt gctctgcgtgctcgggtgtacgacgacgaggtgcgcaagtgggtgacctc taccggtatcgagaacattggcaagaggctggtgaactcgcgggacggac ccgtgacctttgagcagccaaagatgacagtggagaagctgctagagtac gggcacatgcttgtccaggagcaggacaatgtcaagcgtgtgcagcttgc tgacacctacatgagccaggcagctctgggtgatgctaaccaggatgcga tgaagactggttccttctacggttagaacattctccatacacacccacca tctcttgctgcatagga
Download
page-top