Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ725083
Length 174 bp
Fasta Format > whvh8h03
taatcctggggaactggtaatggtttttatttcagtttgtaatctacaac ttctggtgtggcgagtatactatacctaactagagagagaatcgagagat gtaaatgaatcatgtgtatgtcttaacccacttatattgttcaacacggg tgggagtcgaactcaaaaaaaaaa
Download
page-top