Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ724842
Length 841 bp
Fasta Format > whvh7f11
atcaccagcacagccgcgcatccaccgttgctagcaaggtcgaccaagca gcaccgagatggctgctgccttctcctccaccgtcggtgccccggcttct acgccgaccaacttccttgggaagaagctcaagaagcaggtgacctcggc cgtgaactaccatggcaagagctccaaggccaacaggttcacagtcatgg cagcggaaaacctcgacgagaagaggaacacggacaagtggaagggtctt gcgtacgatatctccgacgaccagcaggacatcaccagagggaagggcat cgtggactcgctcttccaggcgcccacgggcgacggcacccacgaggccg tcctcagctcctacgagtacgtcagccagggactcaagaagtacgacttc gacaacaccatgggaggcttctacatcgctcctgctttcatggacaagct tgttgtccatctctccaagaacttcatgaccctgcccaacatcaagatcc cactcatcttgggtatctggggaggcaagggtcaaggaaaatcattccag tgcgagcttgtcttcgccaagatgggcatcaacccaatcatgatgagtgc cggagagctggagagtggcaacgccggagagccagccaagctcatcaggc agcggtaccgtgaggctgcagacatgatcaagaagggtaagatgtgctgc ctcttcatcaacgatcttgacgctggtgcgggtcggatgggcgggaccac acagtacaccgtcaacaaccagatggtgaacgccaccctcatgaacatcg ccgatgcccccaccaacgtgcagctcccaggcatgtacaac
Download
page-top