Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ724824
Length 403 bp
Fasta Format > whvh7d21
gttgcagtgaatgatttcctcccagcagaagatgccatcaacgcaatcaa gtactcgatggacctctacggttcgtacatcatggagggcttaaggaagt gatctccagttggcggactgcggatgctacgcgatccgccctacggctta tcaatagtacgacaaacatctatgttaacatgatgatcgaaaaccatcag tctgttggggatctatatataccttctgtccatgctgagtcaagcatggg tacattttccttccgtatatgccatgtcaggtccaagtatttgacctctt gctggaaccttttttgtcaaaccgtctcttgacagagcggctgcttaata ggaaatcagcgttacgcgaaggcgcgtatgcgtgcctccagtcaaaaaaa aaa
Download
page-top