Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ724741
Length 812 bp
Fasta Format > whvh6n08
gatcaccagcacagccgcgcatccaccgttgctagcaaggtcgaccaagc agcaccgagatggctgctgccttctcctccaccgtcggtgccccggcttc tacgccgaccaacttccttgggaagaagctcaagaagcaggtgacctcgg ccgtgaactaccatggcaagagctccaaggccaacaggttcacagtcatg gcagcggaaaacctcgacgagaagaggaacacggacaagtggaagggtct tgcgtacgatatctccgacgaccagcaggacatcaccagagggaagggca tcgtggactcgctcttccaggcgcccacgggcgacggcacccacgaggcc gtcctcagctcctacgagtacgtcagccagggactcaagaagtacgactt cgacaacaccatgggaggcttctacatcgctcctgctttcatggacaagc ttgttgtccatctctccaagaacttcatgaccctgcccaacatcaagatc ccactcatcttgggtatctggggaggcaagggtcaaggaaaatcattcca gtgcgagcttgtcttcgccaagatgggcatcaacccaatcatgatgagtg ccggagagctggagagtggcaacgccggagagccagccaagctcatcagg cagcggtaccgtgaggctgcagacatgatcaagaagggtaagatgtgctg cctcttcatcaacgatcttgacgctggtgcgggtcggatgggcgggacca cacagtacaccgtcaacaaccagatggtgaacgccaccctcatgaacatc gccgatgccccc
Download
page-top