Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ724721
Length 764 bp
Fasta Format > whvh6l21
gatcaccagcacagccgcgcatccaccgttgctagcaaggtcgaccaagc agcaccgagatggctgctgccttctcctccaccgtcggtgccccggcttc tacgccgaccaacttccttgggaagaagctcaagaagcaggtgacctcgg ccgtgaactaccatggcaagagctccaaggccaacaggttcacagtcatg gcagcggaaaacctcgacgagaagaggaacacggacaagtggaagggtct tgcgtacgatatctccgacgaccagcaggacatcaccagagggaagggca tcgtggactcgctcttccaggcgcccacgggcgacggcacccacgaggcc gtcctcagctcctacgagtacgtcagccagggactcaagaagtacgactt cgacaacaccatgggaggcttctacatcgctcctgctttcatggacaagc ttgttgtccatctctccaagaacttcatgaccctgcccaacatcaagatc ccactcatcttgggtatctggggaggcaagggtcaaggaaaatcattcca gtgcgagcttgtcttcgccaagatgggcatcaacccaatcatgatgagtg ccggagagctggagagtggcaacgccggagagccagccaagctcatcagg cagcggtaccgtgaggctgcagacatgatcaagaagggtaagatgtgctg cctcttcatcaacgatcttgacgctggtgcgggtcggatgggcgggacca cacagtacaccgtc
Download
page-top