Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ724670
Length 825 bp
Fasta Format > whvh6i20
ccgatcaccagcacagccgcgcatccaccgtttgctagcaaggtcgacca agcagcaccgagatggctgctgccttctcctccaccgtcggtgccccggc ttctacgccgaccaacttccttgggaagaagctcaagaagcaggtgacct cggccgtgaactaccatggcaagagctccaaggccaacaggttcacagtc atggcagcggaaaacctcgacgagaagaggaacacggacaagtggaaggg tcttgcgtacgatatctccgacgaccagcaggacatcaccagagggaagg gcatcgtggactcgctcttccaggcgcccacgggcgacggcacccacgag gccgtcctcagctcctacgagtacgtcagccagggactcaagaagtacga cttcgacaacaccatgggaggcttctacatcgctcctgctttcatggaca agcttgttgtccatctctccaagaacttcatgaccctgcccaacatcaag atcccactcatcttgggtatctggggaggcaagggtcaaggaaaatcatt ccagtgcgagcttgtcttcgccaagatgggcatcaacccaatcatgatga gtgccggagagctggagagtggcaacgccggagagccagccaagctcatc aggcagcggtaccgtgaggctgcagacatgatcaagaagggtaagatgtg ctgcctcttcatcaacgatcttgacgctggtgcgggtcggatgggcggga ccacacagtacaccgtcaacaaccagatggtgaacgccaccctcatgaac atcgccgatgccccccaccaacgtg
Download
page-top