Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ724595
Length 719 bp
Fasta Format > whvh6d17
agaagagggtagcacctgatctgcttgcctccagaaacaatggcgtctgc tactctcctcaagtcgtctttccttcccaagaaggccgaatggggcgcca cgcgccaggctgccgcccccaagccgatgaccgtctccatggttgtccgt gccagcgcgtacgccgatgagcttgtcaaaaccgcgaaaaccatcgcatc gccaggcaggggtatccttgccatggatgagtcgaatgccacctgtggca agagactcgcctcgattggccttgagaacactgaggctaaccgccaggct taccggaccctccttgtcactccaccaggattgggaaactacatctctgg tgctatcctctttgaggagaccctctaccagtcgactgttgatggcaaga agattgttgacatccttgtcgagcagggaatcgttcccggtatcaaggtt gacaagggtcttgtgccacttgttggttccaacgatgagtcatggtgcca aggtctcgatggccttgcctcccgtgaagcagcatactaccagcaaggcg cccgcttcgccaagtggcgcactgttgtcagcattcctaatggcccatct gagcttgctgtcaaggaagctgcctggggtcttgcccgttacgcggccat ctcacaggacaatgggctggtgccgattgtggagcctganatcatgctcn acggtgagcacggcatcga
Download
page-top