Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ724577
Length 763 bp
Fasta Format > whvh6c18
tatcgcatcgccaggcaggggtatccttgccatggatgagtcgaatgcca cctgtggcaagagactcgcctcgattggccttgagaacactgaggctaac cgccaggcttaccggaccctccttgtcactccaccaggattgggaaacta catctctggtgctatcctctttgaggagaccctctaccagtcgactgttg atggcaagaagattgttgacatccttgtcgagcagggaatcgttcccggt atcaaggttgacaagggtcttgtgccacttgttggttccaacgatgagtc atggtgccaaggtctcgatggccttgcctcccgtgaagcagcatactacc agcaaggcgcccgcttcgccaagtggcgcactgttgtcagcattcctaat ggcccatctgagcttgctgtcaaggaagctgcctggggtcttgcccgtta cgcggccatctcacaggacaatgggctggtgccgattgtggagcctgaga tcatgctcgacggtgagcacggcatcgagaggaccttcgaggtcgcgcag aaggtgtgggcggagaccttctactacatggcccagaacaacgtcatgtt tgagggcatcctcctgaagccaagcatggtgacccctggtgccgagtgca aggacagggccacccccgaggaagtggccagctacaccctcaagctcctc cagagaaggatccccccttccgtccccggcatcatgttcttgtctggcgg tcantcggaggtg
Download
page-top