Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ724569
Length 760 bp
Fasta Format > whvh6c04
ccagcacagccgcgcatccaccgnttgctagcaaggtcgaccaagcagca ccgagatggctgctgccttctcctccaccgtcggtgccccggcttctacg ccgaccaacttccttgggaagaagctcaagaagcaggtgacctcggccgt gaactaccatggcaagagctccaaggccaacaggttcacagtcatggcag cggaaaacctcgacgagaagaggaacacggacaagtggaagggtcttgcg tacgatatctccgacgaccagcaggacatcaccagagggaagggcatcgt ggactcgctcttccaggcgcccacgggcgacggcacccacgaggccgtcc tcagctcctacgagtacgtcagccagggactcaagaagtacgacttcgac aacaccatgggaggcttctacatcgctcctgctttcatggacaagcttgt tgtccatctctccaagaacttcatgaccctgcccaacatcaagatcccac tcatcttgggtatctggggaggcaagggtcaaggaaaatcattccagtgc gagcttgtcttcgccaagatgggcatcaacccaatcatgatgagtgccgg agagctggagagtggcaacgccggagagccagccaagctcatcaggcagc ggtaccgtgaggctgcagacatgatcaagaagggtaagatgtgctgcctc ttcatcaacgatcttgacgctggtgcgggtcggatgggcgggaccacaca gtacaccgtc
Download
page-top