Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ723784
Length 702 bp
Fasta Format > whvh2i18
tcgtcgcacgtcgcccgggcgttcggcgtcgacgctggcgccaggatcac ctgctccctgcagtccgacatcagggaggtcgcaagcaagtgcgccgacg ccgccaagatggccggcttcgccctcgccacctctgccctcctcgtctcc ggcgcgagcgcggagggggcgcccaagaggctgaccttcgacgagatcca gagcaagacctacatggaggtgaagggtaccggcaccgcgaaccagtgcc cgaccatcgacggcggcgtcgactccttccccttcaaggccggcaagtac gagatgaagaagttctgcctggagcccacctccttcaccgtcaaggccga gggcatccagaagaacgagccgccggccttccagaagaccaagctcatga cccgtctcacctacacccttgacgagatggaaggcccgctcgaggtcggc gccgacggcaccctcaagttcgaggagaaggacggcatcgactacgcggc cgtcaccgtgcagctccccggaggcgagcgcgtgcccttcctcttcaccg tcaagcagctcgtcgccaccggcaagcccgagagcttcagcgggcccttc ctcgtgcccagctacaggggttcgtctttcctcgacccaaagggccgtgg tggctctactggctacnacaacgccgtggcgctacccgccggaggcanag ga
Download
page-top