Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ214207
Length 616 bp
Fasta Format > wh26e23
tcggcacgaggctgccggcggcggagacgacggaaacatggtgcagcgtc tgacctaccggaagaggcacagctatgccaccaagtccaaccagacgcgg gtcgtcaagaccccaggtggtaagctcgtgtaccagtacaccaagaagag ggcgagcggccccaagtgccctgtgaccgggaagaagatccaggggattc cccacctcaggcctactgaatacaaaagatcaaggttgtctaggaaccgc aggactgtgaaccgtccctatggtggagtgctctctggaactgcggtgag ggaaaggatcatccgcgctttcttggttgaggagcagaagatcgtgaaga aggtgttgaaaatacagaagaccaaggacaagacgacctcaaagtaatct gtttgaaacggaagtgcgaagtgagatggtgttctgtaaacaaggaaaat atttttgttggtggttatgatcaatggtttagtcccttctagctaaatgt tttagagtacttgaaatccttctgccgccgtgacatcagagattgtgaaa catttgatacccatttgcagtttcatttctgaatgcatgttgaatctact tgtgttaaaaaaaaaa
Download
page-top