Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ721576
Length 812 bp
Fasta Format > whvh12p18
gccgcgcatccaccgttgctagcaaggtcgaccaagcagcaccgagatgg ctgctgccttctcctccaccgtcggtgccccggcttctacgccgaccaac ttccttgggaagaagctcaagaagcaggtgacctcggccgtgaactacca tggcaagagctccaaggccaacaggttcacagtcatggcagcggaaaacc tcgacgagaagaggaacacggacaagtggaagggtcttgcgtacgatatc tccgacgaccagcaggacatcaccagagggaagggcatcgtggactcgct cttccaggcgcccacgggcgacggcacccacgaggccgtcctcagctcct acgagtacgtcagccagggactcaagaagtacgacttcgacaacaccatg ggaggcttctacatcgctcctgctttcatggacaagcttgttgtccatct ctccaagaacttcatgaccctgcccaacatcaagatcccactcatcttgg gtatctggggaggcaagggtcaaggaaaatcattccagtgcgagcttgtc ttcgccaagatgggcatcaacccaatcatgatgagtgccggagagctgga gagtggcaacgccggagagccagccaagctcatcaggcagcggtaccgtg aggctgcagacatgatcaagaagggtaagatgtgctgcctcttcatcaac gatcttgacgctggtgcgggtcggatgggcgggaccacacagtacaccgt caacaaccagatggtgaacgccaccctcatgaacatcgccgatgccccca ccaacgtgcagc
Download
page-top