Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ721401
Length 399 bp
Fasta Format > whvh12b16
gagcttgtcttcgccaagatgggcatcaacccaatcatgatgagtgccgg agagctggagagtggcaacgccggagagccagccaagctcatcaggcagc ggtaccgtgaggctgcagacatgatcaagaagggtaagatgtgctgcctc ttcatcaacgatcttgacgctggtgcgggtcggatgggcgggaccacaca gtacaccgtcaacaaccagatggtgaacgccaccctcatgaacatcgccg atgcccccaccaacgtgcagctcccaggcatgtacaacaaggaggagaac cctcgtgtgcccatcgtcgtcactggtaacgatttctcgacgttgtacgc ccctctgatccgtgatggccgtatggagaagttctactgggctcccacc
Download
page-top