Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ721190
Length 813 bp
Fasta Format > whvh11b20
agagctaccacaaatcaatcgctcacccttccgcttccaacactaatcaa atcgtcgattccttccaccagcagctcgaatccccatcaacaatgtcgct gatccgccgcagcaacgtgttcgaccccttctccctcgacttcttcgacc cttttgacggcttccccttcggctccggcagcagcaatagcggcggcagc ctcgtcccgcgcacctcctccgacacggcggccttcgcgggcgcgcgcat cgactggaaggagacgcccgaggcgcacgtgttcaaggcggacgtccccg ggctgaagaaggaggaggtgaaggtggaggtggaggacggcaacatcctc cagatcagcggcgagcggaacaaggagcaggaggagaagaccgacacctg gcacagggtggagcgcagcagcggcaagttcctccgcaggttccggctcc cggagaacgccaaggcggagcaggtgaaggcgtcgatggagaacggcgtg ctcaccgtcaccgtgcccaaggaggaggccaagaagcccgacgtcaagtc catccagatctccggctaggcgtctgcgtgctcgctgcgcgatgaggtgg actgcagagcagaggtgtggagtttcgccccggtggtagtgatgaaatta aaaaaaaccanagtccggctgtccgtgcgtgcgctgtgtgtctagtactc tancgttgtgtgcgaataaatctcgtctgtgtttcnagtccantttgctc atccatctgtatttcatcancaactgantaaatccattantatattctct gctaaaaaaaaaa
Download
page-top