Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ721182
Length 788 bp
Fasta Format > whvh11b02
gggcttctcatcgctcctgctttcatggacaagcttgttgtccatctctc caagaacttcatgaccctgcccaacatcaagatcccactcatcttgggta tctggggaggcaagggtcaaggaaaatcattccagtgcgagcttgtcttc gccaagatgggcatcaacccaatcatgatgagtgccggagagctggagag tggcaacgccggagagccagccaagctcatcaggcagcggtaccgtgagg ctgcagacatgatcaagaagggtaagatgtgctgcctcttcatcaacgat cttgacgctggtgcgggtcggatgggcgggaccacacagtacaccgtcaa caaccagatggtgaacgccaccctcatgaacatcgccgatgcccccacca acgtgcagctcccaggcatgtacaacaaggaggagaaccctcgtgtgccc atcgtcgtcactggtaacgatttctcgacgttgtacgcccctctgatccg tgatggccgtatggagaagttctactgggctcccacccgcgacgaccgta tcggtgtctgcaagggtatcttccagaccgacaatgtcagcgacgagtcc gtcgtcaagatcgtcgacaccttcccaggacaatccatcgactttttcgg tgctctgcgtgctcgggtgtacgacgacnaggtgcgcaagtgggtgacct ctaccggtatcnanaacattggcaagaggctggtgaactcgcgggacgga cccgtgacctttgancanccaaagatgacagtgganaa
Download
page-top