Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ721118
Length 793 bp
Fasta Format > whvh10n01
atacagcagacatttttcttagctctccaatggcggcgaccaccacgtcc ctctcctcctcgacctttgctggcaaggcggtgaagaatgtaccatcgcc agctctcttcggcgaggcccgtgtgaccatgcgcaagactgcagcgaagg ctaagcaggtttcctctggcagcccatggtatggtgctgaccgggtgctc tacctcggcccactctctggtgagcccccgagctacctgaccggtgagtt tcctggtgactatgggtgggacactgctgggctttcagctgaccccgaga ctttcgccaagaaccgggagctcgaagtgatccactgtcgctgggccatg ctcggagcacttggttgtgtctttccggagttgctggcccgcaatggcgt gaagttcggtgaggccgtttggtttaaggccggctcccaaatctttagtg agggtggtcttgactatcttggcaaccccagcctcgtccacgcgcaaagc atcctagctatttgggcatgccaggtcgtgctcatgggtgctgttgaggg gtaccgcattgccggtggcccgcttggtgagatcgtcnacccactctacc caggcggcagcttcnaccctcttggcctanctgacgaccctgaggcattt tccnagctcaaggtgaanganatcaanaatggtcgtcttgccatgttctc aatgtttggcttctttgtccaanctatcgtcacnggcaagggccctcttg anaaccttgctgaccacatcnccgaccctgtcaacaacaatgc
Download
page-top