Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ721012
Length 804 bp
Fasta Format > whvh10g05
agctatatacctacatagtacagccatggcccccaccgtgatggcctcgt cggccacctccgtcgctcctttccaggggctcaagtccaccgccggcctc cccgtcagccgccgctccaacggcgctagcctcggcagcgtcagcaacgg tggaaggatcaggtgcatgcaggtgtggcccatcgagggcatcaagaagt tcgagaccctgtcttacctgccaccgctcagcacggaggccctcctcaag caggtcgactacctgatccgctccaagtgggtgccttgcctcgagttcag caaggttgggttcatcttccgtgagcacaacgcatctcctgggtactacg atggccggtattggacaatgtggaagctgcctatgttcgggtgcactgac gccacacaggtgatcaacgaggtggaggaggtcaagaaggagtaccctga cgcgtatgtccgcatcatcggattcgacaacatgcgtcaggtgcagtgcg tcagcttcatcgccttcaagccaccgggctgcgaggagtccggcaaggcc taaacagctcactcacgacaggccatatataaagtgccattgcagttttg tcaactctgacattgctttgggttttccttctccatttatctttcttatt tgttcctaagaatatgtgtatgtccatgttcatgtaccaacatggctcga gaaagcatgctcgtatgtgaatgctatcggtggctatgtatatgcacgga cgcataatattatacaatatgtcaactatatacgttttaatggtaaaaaa aaaa
Download
page-top