Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ721004
Length 794 bp
Fasta Format > whvh10f19
cagctatatacctacatagtacagccatggcccccaccgtgatggcctcg tcggccacctccgtcgctcctttccaggggctcaagtccaccgccggcct ccccgtcagccgccgctccaacggcgctagcctcggcagcgtcagcaacg gtggaaggatcaggtgcatgcaggtgtggcccattgagggcatcaagaag ttcgagaccctgtcctacttgccaccgctcagcacggaggccctcctcaa gcaggtcgactacctgatccgctccaagtgggtgccttgcctcgagttca gcaaggttgggttcatcttccgtgagcacaacgcatcccctgggtactat gatggccggtactggacaatgtggaagctgcctatgttcgggtgcaccga cgccacacaagtgatcaacgaggtggaggaggtcaagaaggagtaccctg acgcgtatgtccgcatcatcggattcgacaacatgcgccaggtgcagtgc gtcagcttcatcgccttcaagccaccgggctgcgaggagtccggcaaggc ctaaacagctcactcacgacaggccatatataaagtgccattgcagtttt gtcaactctgacattgctttgggttttccttctccatttatctttcttat ttgttcctaagaatatgtgtatgtccatgttcatgtaccaacatggctcg agaaagcatgctcgtatgagaatgctatcggtggctatgtatatgaacgg acgcataatattatacaatatgtcgactatatacgttttaatgg
Download
page-top