Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ721003
Length 255 bp
Fasta Format > whvh10f17
gtatgcaggaagcgagttcaagggttcggaaggcgagtacattgttctca ggtcatccgacgtgatagcggtgctgtcatcataagcttgccctgcccta cgtgaactaggaattttgatatttagtccaaaaccttgtttggttattgc tctttgcttgtgattggtgaactgtgaattgcttcttcgctctatcgtgg aaatgctgcttgatagttttaataagatgacggcttagacttcagaaaaa aaaaa
Download
page-top