Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ721002
Length 768 bp
Fasta Format > whvh10f16
cgtcgctgaccgcggccgccgccgctacctcgtcgtttccgccgcaaatc cgtcgccgaatcatcaaattcaacccgcccgtgctccctaggcgacccca attccgagactccaagatctggaccgccaacttccggggacacctggctg cggcctcggcatccacgccgccgccgccgggaggcggcctgtactcggcg gtgacctacgaactgacgccaggtaacgtcgaccgcgtcctcgacgacgt gcgcccctacctcatctccgacggcggcgacgtcgccgtcgtgtccgtcg aggacggcgtcgtctcccttaggcttgaaggggcgtgcagcagttgtcca agctcgacgacgacgatgaacatgggcatcgagcgagtgctcaaggagaa gttcggtgacgccatcaaggacatccgccaggtgttcgacggggaccagc agccggaggagacaacgcctgaggcggtgaaccggcacctggacatactg cggccggcgatcgcgaactacggcgggagtgtgaaggttcttgccgttga cggcgaggactgcctggttaagtatgacggcccagagtccatcggaagtg gagtgaaggcagccatcaaggagaagttccccgacatcacgaatgtggtg ttcacccantgatctacaggtangctggccggcttgatgccactccantg cantaaaatggcgacatgtacnacatgcancaagattttgtttcnatgta tcntctaggcaagagttt
Download
page-top