Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ721001
Length 808 bp
Fasta Format > whvh10f14
aggggcagactgttggagtgatcggagctggccgcatcggctcagcttat gcaaggatgatgattgaggggttcaagatgaacttgatctacttcgacct gtaccagtccacacggctcgagaaattcgtcacagcgtatggccagttcc tgaaagccaatggtgagcagcctgtgacatggaagagggcctccagcatg gaggaagttctcagggaggccgatgtgataagcctgcacccagtgctgga caagacgacgtaccacctgataaaccctgagcggctggcgatgatgaaga aggaggcagtgctggtgaacgccagccgtggcccggtgatcgacgaggtt gcactggtggagcacctgagggcgaatcccatgttccgtgttggcctcga tgtttttgaggatgagccttacatgaagccagggctggctgagatgaaga atgccgtcgtcgtgcctcacatcgcatctgcatcgaagtggacgcgtgaa gggatggcgacgctcgctgctctgaacgtgcttggtaagatcaaggggta cccggtgtgggggaacccgaacacggtggagcccttcctcgacgagaagg cggcgccgccccctgcctgcccaagcatcgttaacgccaagcaactcggc ctgccatcttccaagctttangcagaggcagaggcanagatggatgaatc actgctactactactactacttgctaanatgctatgcatatatanctcct tcccantatatatgtatgaatgccctcatcctcatgggagtancantact gaatgaat
Download
page-top