Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ721000
Length 760 bp
Fasta Format > whvh10f11
atggctctgaggctgtgggcaagctcagctgccaatgccctcaagatttc aagcagcggcgccagggccgctgccccggcctactcgatctccagatact tcttcaccgttattgatggcttgaagtacacttcctcccacgagtgggtc aagaacgacggctccgtggccacgattggcatcagtgaccacgcccaggg ccatctcggggaggtggtgttcgtggagctgccggagaccggcacgaagg tgagccagggtggggccttcggcaacgtggagagtgtgaaggccaccagc gacgtcaactcgcccatctccggcgaggtcgtcgaggtcaattcgaagct gtccgagaccccgggcctgatcaactcgagcccgtacgaggaggggtgga tgatcaaggtgaagccgagcagcccggcggagctggagggcctgctggac tcggccaagtacaccaagcactgcgaggaggaggacgcccactagtgctc ccttgttcgcttatcaatccttttgctgcaaccatatcgaatactcttgt ctacaataattaaaccancttcaccatgcgttcagttcatcggttccaat tttcttgtgtcngtgtacatggcggccancactttgttataccatttcan tgaccgtgacatcananatatgggaaanantttgtaanttatantgtgtt ggtaaaaananacattatcatccaccaacaaatcatcatatataactact ctaatatggt
Download
page-top