Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720998
Length 835 bp
Fasta Format > whvh10f09
cttgttgttcttatctaagattttggagtagatcttgtgccctaggagtt ctggattgaactcttgctgtcctatcagcctacgttcgcctctagagcga tatctagcgcaacattttgaaactgttccttcaacacttgtgatgtacac attgtagcagcaaggtggagttgctccttcacaacctttgtgctgcttca attaccatcacaatttccactctcgtgaccatccatgttgccatgtgcac tcacccccgcaaccgcacctcctaccatcttcgttgctaaaatttgtgcc tttgtcaactcaagatactgaagctgagaggtgtcaaaacctacaggtct cgtgagcatgatcttgtactcttcctctattttcttcgccggcatgacga ggtggcggggaatggcgcttccctacttccccgcaggttggctacggacg agctgcttgcccgttgggctgcccgggccgggttggcggcgatggccgat ggtggagtcagccaaggcgggcgacgaggccacgacggacacgggcaact gatcgggatcggcggcgtgacggacgtcagggtcggcgggggctacaggc gaaggtacgtgaaacttcacccgggagaaaaagttttcttttttgcgcta tgtttaggaaaggtttacgggaagggctatattcccctanaattgagggg aagttgagctgattatacggtgtttcctaaagaaaaatcgtgcttacgga cctgttgggagcagttttttctcgtccaactcactctaaaccancttttt gttacgggaaagggacttgttggaaatgctcttta
Download
page-top