Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720995
Length 797 bp
Fasta Format > whvh10f04
taagtgctcttaagggagagaatgttgatgagctattagagactgtcatg cttgttgctgagttgctagaattaaaagccaatcctcatagaaatgcaaa gggtacggttattgaagcatgtcttgacaaggctaaaggacctcttgcca ccctagttgtacagaatggaaccttgaataagggcgatattcttgtttgt ggtgaagcttttggaaagatccgtgcaatgtatgatgatcgtggaagcct tgtagaccaagcagcgccatccaacgccgtgcagattattggcttgaaca atgtaccccttgctggtgacgaatttgagtctgttgatgaccttgatgtt gcacgcgaaagggcaaacgcgcgtgccgatgcaatgagaattgaaaggat aaatgcgaaagctggggaaggaaaagtcactctgtcatccattgcagctt ccatttcatctgggaatcaagtagggattgatacgcatgggttaaatgtc atacttaaagttgattttcagggttcaattgaggccattaggcaagccat tcaagcgctgcctcaagaaaatgtctctttgagattcctacttcaagctc caggagatgtgagcctcagtgatgttgatctggctgttgcttcggaagga attgtatttggttttaatgtcaaagctccggggccagttaagaaatatgc taagcagaaaagtgtggagattcgattgtacaaagtgatctatgatttga tagatgatttacgcaatgccatggaagggcttcttgaccttgctgag
Download
page-top