Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720992
Length 658 bp
Fasta Format > whvh10e20
attcgtagcacatcggcttccaagttccaacgatctcgtagacactctct cgtttcaattctcgagcgacttttaatctttcaaagtgcaatggctgctg cgaatgcccccttcgctctcagtcgcctctccccggccgcgcgcctgccg atccgtgcctggagagccgcgaggccggccccggtctggaccgggagaac ccgcccgctctccgtggcctccgcggcgcaagagaatagggacaactccg tcgacgtccaagtcagccaggcccagaacggcggcaaccagcagggcaac gctgtccagcgccggccgcgccgcgccggatttgacatctccccgttcgg gctagtggacccgatgtcgccgatgaggacgatgcggcagatgctggaca cgatggaccggctgttcgatgacgccgtagggttccccacggcgcggcgc tcgccggcggcggctagcgagatgccgcggatgccgtgggacatcatgga ggacgacaaggaggtgaagatgcggttcgacatgcccgggctgtcgcgga aggaggtgaaggtgatggtggagggcgacgcgctcgtcatccgcggcgag cacaagaaggaggccggcgaagggcaggtcgaaggcggcgacgggtggtg gaagganc
Download
page-top