Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720991
Length 719 bp
Fasta Format > whvh10e19
cgttcccggtatcaagggttgacaagggtcttgtgccacttgttggttcc aatgatgagtcgtggtgccaaggtctcgatggccttgcctcccgtgaagc agcatactaccagcaaggcgctcgcttcgccaagtggcgcactgttgtca gcattcctaacggcccatctgagcttgctgtcaaggaagctgcctggggt cttgcccgttacgcggccatctcacaggacaatgggctggtgccgattgt ggagcctgagatcatgctcgacggtgagcacggcatcgagaggaccttcg aggtcgcacagaaggtgtgggcggagaccttctactacatggctcagaac aacgtcatgtttgagggcatcctcctgaagccaagcatggtgacccctgg tgctgagtgcaaggacagggccacccctgaggaagtagccagctacaccc tcaagctcctccagagaaggatccccccttccgtccccggcatcatgttc ttgtctggcggtcagtcggaggttgaggcaacgctgaacctcaacgcgat gaaccaggcgccgaacccgtggcacgtgtccttctcctacgcgcgggcgc tgcagaacacctgcctcaagacgtggggcgggcggccggagaacgtggcc gcggcgcangaggcgctgctgctgcgcgccaaggccaactccctggcgca nctcggcaagtacaccanc
Download
page-top