Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720983
Length 855 bp
Fasta Format > whvh10e06
tcgacacatatggctagccaaatatctggtaccatagcatctagtggggt gtgctataatgataaacacagaatgccgtgtaagctgaaagcactacgct gcgtagcatcgaattgtttaccactagaggtagaggtaaggaagtggatg aacggatgtcatatcatcaggtcctttccaaacgataggcattggaaaac gaatgcgaagtccaatggttacctactccaacaaggtccgaatgtttggt gccattcttatggttctcgtagtgccagtgaaactaaagagtgcaatatt cctgaagatggcaacaatccttacagggattttgatgagcatccaagagg aatgtcacatttttcagatagtcaagttgcagctcaggaaaaaacactat attctactcaagggctgtctaaagcgtgccaatttgtctataatgatgca aagtttgtgaatgaaagagctcagagtgatattcttttgctttcacgtgg catcacaaggttgaacaaacgtgcatctaaggatgttgctgtattaggat tggggtttctcaagcttgatgctcgtgcaaggaaggacacccgaaagatt gataacagtgtgaaggaacgggcagcccacctaaccaattttgctagaat attgaaggagcgagctcattcagacttgaagaaagcagcagatcaacatt ggagtgatggtgctttggaggcagatctgcgacgagctgacatggttgtt cgacgacgtgccatgganggatgctttcatggctttaaagtttgttcggg atattcatgacatgatggcaaccaaactacaatatcatccttatttaaac tatat
Download
page-top